화학공학소재연구정보센터
Inorganic Chemistry, Vol.37, No.16, 3964-3967, 1998
GG versus AG platination : A kinetic study on hairpin-stabilized duplex oligonucleotides
The kinetics of the reactions between the diaqua form of the antitumor drug cisplatin, cis- [Pt(NH3)(2)(H2O)(2)](2+) and two hairpin-stabilized duplex oligonucleotides, d(TATGGTATTTTTATACCATA) (I) and d(TATAG'TATTTTTATACTATA) CII), were investigated. Oligonucleotides I and II were used as models for GG and AG sequences within duplex DNA, which are known as the. major sites of platinum binding. The two GG guanines of I are shown to react with similar rates (k(5') = 18 +/- 2 and k(3') = 15 +/- 1 M-1 s(-1)), roughly twice as fast as the AG guanine of II (k(3') = 9 +/- 1 M-1 s(-1)). Platination of the AG adenine of II was also observed to a minor extent (k(5') = 1.5 +/- 0.3 M-1 s(-1)), whereas no other adenine of I or II was platinated to a detectable extent. The overall platination rate of I is approximately three times larger than that of II. The 3'-monoadduct of I undergoes chelation to the GG intrastrand adduct with a rate 10.5 times larger than the 5'-monoadduct (k(3'c) = (1.9 +/- 0.1) x 10(-3) s(-1) and k(5'c) = (0.18 +/- 0.05) x 10(-3) s(-1)). For II, the chelation rate constants of the guanine- and adenine-bound monoadducts are k(5'c) = 0.3 +/- 0.1 and k(3'c) = 0.08 +/- 0.01 s(-1), respectively. These results are discussed in relation to the platination kinetics determined for other model systems.